monse1745 monse1745

01-08-2017
English

contestada

A word that reverses an idea is called a(n) _____.

A. verbal cue
B. supporting signal
C. opposing signal
D. presentation cue

Respuesta :

1998jzavjzav 1998jzavjzav

01-08-2017

C. Opposing signal.
Like the opposing side the opposite

Answer Link

jaydensmith1962 jaydensmith1962

23-01-2019

Answer is C. Opposing signal.(APEX)

Opposing aka opposite :)

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which is the correct way to rewrite the phrase? the house of Molly and Harriet A. Molly's and Harriet's house B. Molly and Harriet's house C. Mollies and Harrie

For how many different values of θ between 0 and 2π radians is sec x = csc x ?

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

How are logos, pathos, and ethos I used in an argument

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th

Today many educators would like math instruction to be more active and engaging instead of based on rote memory of principles and definitions. a. True b. Fals

Solve for x. Assume that lines which appear tangent are tangent.